Lab Reagents

Human IgG antibody Laboratories manufactures the il6r antibody pig reagents distributed by Genprice. The Il6R Antibody Pig reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact pig Antibody. Other Il6R products are available in stock. Specificity: Il6R Category: Antibody Group: Pig

Pig information

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
RDR-IL6R-Ra-96Tests	Reddot Biotech	96 Tests	EUR 685

Human Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Hu-48Tests	Reddot Biotech	48 Tests	EUR 439

Human Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Hu-96Tests	Reddot Biotech	96 Tests	EUR 606

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Mu-48Tests	Reddot Biotech	48 Tests	EUR 450

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Mu-96Tests	Reddot Biotech	96 Tests	EUR 622

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Ra-48Tests	Reddot Biotech	48 Tests	EUR 473

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
RD-IL6R-Ra-96Tests	Reddot Biotech	96 Tests	EUR 655

IL6R Antibody
32315-100ul	SAB	100ul	EUR 252

IL6R Antibody
1-CSB-PA006108	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IL6R. Recognizes IL6R from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

IL6R ELISA Kit (Pig) (OKEH08430)
OKEH08430	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7pg/mL

Anti-IL6R Antibody
A01425-1	BosterBio	100ug/vial	EUR 294

IL6R Conjugated Antibody
C32315	SAB	100ul	EUR 397

anti- IL6R antibody
FNab04284	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:200 IP: 1:500-1:1000 Immunogen: interleukin 6 receptor Uniprot ID: P08887 Gene ID: 3570 Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against IL6R

Anti-IL6R antibody
PAab04284	Lifescience Market	100 ug	EUR 386

Anti-IL6R antibody
STJ24189	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.

Il6r/ Rat Il6r ELISA Kit
ELI-05861r	Lifescience Market	96 Tests	EUR 886

IL6R siRNA
20-abx920538	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-IL6R
YF-PA12689	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to IL6R

anti-IL6R
YF-PA12690	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IL6R

anti-IL6R
YF-PA12691	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IL6R

anti-IL6R
YF-PA23981	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to IL6R

Pig Interleukin 6 Receptor (IL6R) ELISA Kit
abx361793-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Interleukin 6 Receptor (IL6R) ELISA Kit
abx518525-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig Interleukin 6 Receptor (IL6R) ELISA Kit
abx357322-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

IL6R alpha protein
30R-AI080	Fitzgerald	5 ug	EUR 133
Description: Purified recombinant Human IL6R alpha protein

IL6R Rabbit pAb
A1570-100ul	Abclonal	100 ul	EUR 308

IL6R Rabbit pAb
A1570-200ul	Abclonal	200 ul	EUR 459

IL6R Rabbit pAb
A1570-20ul	Abclonal	20 ul	EUR 183

IL6R Rabbit pAb
A1570-50ul	Abclonal	50 ul	EUR 223

IL6R (partial) Peptide
20-abx266289	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

IL6R cloning plasmid
CSB-CL011665HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1407 Sequence: atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgccgggagcggcgctggccccaaggcgctgccctgcgcaggaggtggcaagaggcgtgctgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttc Show more
Description: A cloning plasmid for the IL6R gene.

IL6R cloning plasmid
CSB-CL011665HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1407 Sequence: atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgccgggagcggcgctggccccaaggcgctgccctgcgcaggaggtggcgagaggcgtgctgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttc Show more
Description: A cloning plasmid for the IL6R gene.

Anti-IL6R (2G6)
YF-MA13745	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to IL6R

Anti-IL6R (1E11)
YF-MA13746	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to IL6R

Polyclonal IL6R / IL6 Receptor Antibody
APR02815G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL6R / IL6 Receptor . This antibody is tested and proven to work in the following applications:

Interleukin 6 Receptor (IL6R) Antibody
20-abx177196	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102264	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102265	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102266	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102267	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102268	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx102269	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
abx037368-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx130195	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx130196	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody
abx145626-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx173186	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Interleukin 6 Receptor (IL6R) Antibody
abx234284-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx323401	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody
20-abx001321	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)
20-abx272194	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)
20-abx272798	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)
20-abx273266	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)
20-abx274554	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-IL6R / CD126 (isoform 1) antibody
STJ70862	St John's Laboratory	100 µg	EUR 260

Human IL6R ELISA Kit
ELA-E1815h	Lifescience Market	96 Tests	EUR 824

Human IL6R shRNA Plasmid
20-abx952387	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IL6R Recombinant Protein (Human)
RP040078	ABM	100 ug	Ask for price

Mouse IL6R ELISA Kit
STJ150546	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of sIL-6R in Mouse serum, plasma and other biological fluids

Monoclonal IL6R Antibody (monoclonal) (M01), Clone: 2G6
APR16832G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human IL6R (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse)
4-PAB815Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse)
4-PAB815Mu02	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)
4-PAB815Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)
4-PAB815Ra02	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)
4-PAB815Ra03	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)
4-PAB815Ra04	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)
4-PAB815Ra05	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Active Interleukin 6 Receptor (IL6R)
4-APB815Mu02	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22272 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.0kDa Isoelectric Point: 6.5
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Il6r ORF Vector (Rat) (pORF)
ORF068647	ABM	1.0 ug DNA	EUR 506

h IL6R inducible lentiviral particles
LVP613	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: IL6R (interleukin 6 receptor, transcript variant 3), [alternative names: CD126; gp80; IL-6R-1; IL-6RA; IL6Q; IL6RA; IL6RQ]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001206866 . It also contains a RFP-Blasticidin dual selection marker.

IL6R ORF Vector (Human) (pORF)
ORF013359	ABM	1.0 ug DNA	EUR 95

IL6R ORF Vector (Human) (pORF)
ORF013360	ABM	1.0 ug DNA	EUR 95

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08887 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Mu01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22272 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.0kDa Isoelectric Point: 6
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Mu02	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22272 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Ra01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22273 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 10.1kDa Isoelectric Point: 9.3
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Ra02	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22273 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.0kDa Isoelectric Point: 6.1
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Ra03	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22273 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.0kDa Isoelectric Point: 5.7
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)
4-RPB815Ra04	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22273 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.0kDa Isoelectric Point: Inquire
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

IL6R ELISA Kit (Human) (OKAN04562)
OKAN04562	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

IL6R ELISA Kit (Rat) (OKAN06520)
OKAN06520	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

IL6R ELISA Kit (Human) (OKBB00811)
OKBB00811	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: IL6R alpha(IL6RA) also known as CD126 or IL6R, is a type I cytokine receptor. The IL6 receptor is a protein complex consisting of a IL-6 receptor subunit(IL6R) and interleukin 6 signal transducer Glycoprotein 130. IL6R also denotes the human gene encoding this subunit. Alternatively spliced transcript variants encoding distinct isoforms have been reported. IL6R subunit is also shared by many other cytokines. Interleukin-6 receptor has been shown to interact with Interleukin 6 and Ciliary neurotrophic factor. Ligand binding did not appear to affect IL6R dimerization status. IL6R dimerization occurs both on the cell surface and in solution.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL6R ELISA Kit (Human) (OKCD07685)
OKCD07685	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.67ng/mL

IL6R ELISA Kit (Rat) (OKCD07687)
OKCD07687	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: alpha subunit of the interleukin 6 receptor complex.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

IL6R ELISA Kit (Rat) (OKEH04094)
OKEH04094	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: alpha subunit of the interleukin 6 receptor complex [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.32 pg/mL

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC
4-PAB815Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Biotinylated
4-PAB815Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Cy3
4-PAB815Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), FITC
4-PAB815Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), HRP
4-PAB815Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), PE
4-PAB815Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC
4-PAB815Mu02-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Biotinylated
4-PAB815Mu02-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Cy3
4-PAB815Mu02-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), FITC
4-PAB815Mu02-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), HRP
4-PAB815Mu02-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), PE
4-PAB815Mu02-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC
4-PAB815Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated
4-PAB815Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3
4-PAB815Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC
4-PAB815Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP
4-PAB815Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE
4-PAB815Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC
4-PAB815Ra02-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated
4-PAB815Ra02-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3
4-PAB815Ra02-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC
4-PAB815Ra02-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP
4-PAB815Ra02-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE
4-PAB815Ra02-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC
4-PAB815Ra03-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated
4-PAB815Ra03-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3
4-PAB815Ra03-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC
4-PAB815Ra03-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP
4-PAB815Ra03-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE
4-PAB815Ra03-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC
4-PAB815Ra04-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated
4-PAB815Ra04-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3
4-PAB815Ra04-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC
4-PAB815Ra04-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP
4-PAB815Ra04-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE
4-PAB815Ra04-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC
4-PAB815Ra05-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated
4-PAB815Ra05-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3
4-PAB815Ra05-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC
4-PAB815Ra05-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP
4-PAB815Ra05-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE
4-PAB815Ra05-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Rat Interleukin 6 Receptor (IL6R) Protein
20-abx167762	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) Protein
20-abx167763	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Interleukin 6 Receptor (IL6R) Protein
20-abx067543	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein
20-abx067544	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein
20-abx067545	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Interleukin 6 Receptor (IL6R) Protein
20-abx067546	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) Protein
20-abx067548	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Anti-IL6R (Tocilizumab)-SMCC-DM1 ADC
ADC-W-1442	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a SMCC linker to DM1

Anti-IL6R (Tocilizumab)-SPDB-DM4 ADC
ADC-W-1443	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a SPDB linker to DM4

Anti-IL6R (Tocilizumab)-MC-MMAF ADC
ADC-W-1444	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a MC linker to MMAF

Il6r sgRNA CRISPR Lentivector set (Rat)
K6857401	ABM	3 x 1.0 ug	EUR 339

IL6R sgRNA CRISPR Lentivector set (Human)
K1076501	ABM	3 x 1.0 ug	EUR 339

Recombinant IL6R Protein (Met1-Pro365) [His]
VAng-Cr3770-100g	Creative Biolabs	100 µg	EUR 1388
Description: Recombinant IL6R Protein (Met1-Pro365) fused with a His tag at C-terminus was expressed in Mammalian cells, with a molecular weight of 65 kDa. (Uniprot ID: P08887)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Human, Mouse, Rat)
4-PAB815Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Pro216~Val356) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB815Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Phe205~Glu347) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB815Mu02-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala52~Ala204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7
4-PAB815Ra01-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Leu385~Arg462) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7
4-PAB815Ra02-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7
4-PAB815Ra03-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Asp214~Ala348) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7
4-PAB815Ra04-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL6R (Ala19~Val108) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7
4-PAB815Ra05-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala19~Val10 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Human Interleukin-6 receptor subunit alpha (IL6R)
1-CSB-YP011665HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 40.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-6 receptor subunit alpha(IL6R),partial expressed in Yeast

Human Interleukin 6 Receptor, IL6R ELISA Kit
DEIA262	Creative Diagnostics	5 plates	EUR 1361
Description: The Human IL6R ELISA kit is for the quantitative determination of Human IL6R.;This ELISA kit contains the basic components required for the development of sandwich ELISAs. Each kit contains sufficient materials to run ELISAs on five 96-well plates.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
20-abx155686	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit
20-abx154201	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit
20-abx151950	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
abx255770-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Interleukin 6 Receptor (IL6R) ELISA Kit
abx257871-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit
abx253572-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rabbit Interleukin 6 Receptor (IL6R) ELISA Kit
abx362587-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Interleukin 6 Receptor (IL6R) ELISA Kit
abx357164-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit
abx573463-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit
abx574107-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein (Active)
20-abx651400	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit
abx575657-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit
abx518524-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) CLIA Kit
20-abx493109	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Interleukin 6 Receptor (IL6R) CLIA Kit
20-abx493110	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Interleukin 6 Receptor (IL6R) CLIA Kit
20-abx493111	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Il6r sgRNA CRISPR Lentivector (Rat) (Target 1)
K6857402	ABM	1.0 ug DNA	EUR 154

Il6r sgRNA CRISPR Lentivector (Rat) (Target 2)
K6857403	ABM	1.0 ug DNA	EUR 154

Il6r sgRNA CRISPR Lentivector (Rat) (Target 3)
K6857404	ABM	1.0 ug DNA	EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 1)
K1076502	ABM	1.0 ug DNA	EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 2)
K1076503	ABM	1.0 ug DNA	EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 3)
K1076504	ABM	1.0 ug DNA	EUR 154

IL6R Protein Vector (Rat) (pPB-C-His)
PV274586	ABM	500 ng	EUR 603

IL6R Protein Vector (Rat) (pPB-N-His)
PV274587	ABM	500 ng	EUR 603

IL6R Protein Vector (Rat) (pPM-C-HA)
PV274588	ABM	500 ng	EUR 603

IL6R Protein Vector (Rat) (pPM-C-His)
PV274589	ABM	500 ng	EUR 603

IL6R Protein Vector (Human) (pPB-C-His)
PV053433	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPB-N-His)
PV053434	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPM-C-HA)
PV053435	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPM-C-His)
PV053436	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPB-C-His)
PV053437	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPB-N-His)
PV053438	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPM-C-HA)
PV053439	ABM	500 ng	EUR 481

IL6R Protein Vector (Human) (pPM-C-His)
PV053440	ABM	500 ng	EUR 481

Human Interleukin 6 Receptor(IL6R)ELISA Kit
QY-E04261	Qayee Biotechnology	96T	EUR 374

Rat Interleukin 6 Receptor(IL6R)ELISA Kit
QY-E10061	Qayee Biotechnology	96T	EUR 361

Human Interleukin 6 Receptor (IL6R) ELISA Kit
SEB815Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.

Human Interleukin 6 Receptor (IL6R) ELISA Kit
SEB815Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.

Human Interleukin 6 Receptor (IL6R) ELISA Kit
SEB815Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.