Urokinase

urokinase-type plasminogen activator (uPA)

fallback-image

Il6R Antibody Pig

Lab Reagents

Human IgG antibody Laboratories manufactures the il6r antibody pig reagents distributed by Genprice. The Il6R Antibody Pig reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact pig Antibody. Other Il6R products are available in stock. Specificity: Il6R Category: Antibody Group: Pig

Pig information

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

RDR-IL6R-Ra-96Tests 96 Tests
EUR 685

Human Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Hu-96Tests 96 Tests
EUR 606

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Mu-48Tests 48 Tests
EUR 450

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Mu-96Tests 96 Tests
EUR 622

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Ra-48Tests 48 Tests
EUR 473

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

RD-IL6R-Ra-96Tests 96 Tests
EUR 655

IL6R Antibody

32315-100ul 100ul
EUR 252

IL6R Antibody

1-CSB-PA006108
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IL6R. Recognizes IL6R from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

IL6R ELISA Kit (Pig) (OKEH08430)

OKEH08430 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7pg/mL

Anti-IL6R Antibody

A01425-1 100ug/vial
EUR 294

IL6R Conjugated Antibody

C32315 100ul
EUR 397

anti- IL6R antibody

FNab04284 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:200
  • IP: 1:500-1:1000
  • Immunogen: interleukin 6 receptor
  • Uniprot ID: P08887
  • Gene ID: 3570
  • Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against IL6R

Anti-IL6R antibody

PAab04284 100 ug
EUR 386

Anti-IL6R antibody

STJ24189 100 µl
EUR 277
Description: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.

Il6r/ Rat Il6r ELISA Kit

ELI-05861r 96 Tests
EUR 886

IL6R siRNA

20-abx920538
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IL6R

YF-PA12689 50 ul
EUR 363
Description: Mouse polyclonal to IL6R

anti-IL6R

YF-PA12690 50 ug
EUR 363
Description: Mouse polyclonal to IL6R

anti-IL6R

YF-PA12691 100 ug
EUR 403
Description: Rabbit polyclonal to IL6R

anti-IL6R

YF-PA23981 50 ul
EUR 334
Description: Mouse polyclonal to IL6R

Pig Interleukin 6 Receptor (IL6R) ELISA Kit

abx361793-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Interleukin 6 Receptor (IL6R) ELISA Kit

abx518525-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Interleukin 6 Receptor (IL6R) ELISA Kit

abx357322-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

IL6R alpha protein

30R-AI080 5 ug
EUR 133
Description: Purified recombinant Human IL6R alpha protein

IL6R Rabbit pAb

A1570-100ul 100 ul
EUR 308

IL6R Rabbit pAb

A1570-200ul 200 ul
EUR 459

IL6R Rabbit pAb

A1570-20ul 20 ul
EUR 183

IL6R Rabbit pAb

A1570-50ul 50 ul
EUR 223

IL6R (partial) Peptide

20-abx266289
  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

IL6R cloning plasmid

CSB-CL011665HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1407
  • Sequence: atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgccgggagcggcgctggccccaaggcgctgccctgcgcaggaggtggcaagaggcgtgctgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttc
  • Show more
Description: A cloning plasmid for the IL6R gene.

IL6R cloning plasmid

CSB-CL011665HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1407
  • Sequence: atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgccgggagcggcgctggccccaaggcgctgccctgcgcaggaggtggcgagaggcgtgctgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttc
  • Show more
Description: A cloning plasmid for the IL6R gene.

Anti-IL6R (2G6)

YF-MA13745 100 ug
EUR 363
Description: Mouse monoclonal to IL6R

Anti-IL6R (1E11)

YF-MA13746 100 ug
EUR 363
Description: Mouse monoclonal to IL6R

Polyclonal IL6R / IL6 Receptor Antibody

APR02815G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL6R / IL6 Receptor . This antibody is tested and proven to work in the following applications:

Interleukin 6 Receptor (IL6R) Antibody

20-abx177196
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102264
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102265
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102266
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102267
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102268
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx102269
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

abx037368-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx130195
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx130196
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 6 Receptor (IL6R) Antibody

abx145626-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx173186
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 6 Receptor (IL6R) Antibody

abx234284-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx323401
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody

20-abx001321
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)

20-abx272194
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)

20-abx272798
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)

20-abx273266
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Interleukin 6 Receptor (IL6R) Antibody (Biotin)

20-abx274554
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-IL6R / CD126 (isoform 1) antibody

STJ70862 100 µg
EUR 260

Human IL6R ELISA Kit

ELA-E1815h 96 Tests
EUR 824

Human IL6R shRNA Plasmid

20-abx952387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IL6R Recombinant Protein (Human)

RP040078 100 ug Ask for price

Mouse IL6R ELISA Kit

STJ150546 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of sIL-6R in Mouse serum, plasma and other biological fluids

Monoclonal IL6R Antibody (monoclonal) (M01), Clone: 2G6

APR16832G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IL6R (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse)

4-PAB815Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse)

4-PAB815Mu02
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)

4-PAB815Ra01
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)

4-PAB815Ra02
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)

4-PAB815Ra03
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)

4-PAB815Ra04
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat)

4-PAB815Ra05
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R)

Active Interleukin 6 Receptor (IL6R)

4-APB815Mu02
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22272
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Il6r ORF Vector (Rat) (pORF)

ORF068647 1.0 ug DNA
EUR 506

h IL6R inducible lentiviral particles

LVP613 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: IL6R (interleukin 6 receptor, transcript variant 3), [alternative names: CD126; gp80; IL-6R-1; IL-6RA; IL6Q; IL6RA; IL6RQ]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001206866 . It also contains a RFP-Blasticidin dual selection marker.

IL6R ORF Vector (Human) (pORF)

ORF013359 1.0 ug DNA
EUR 95

IL6R ORF Vector (Human) (pORF)

ORF013360 1.0 ug DNA
EUR 95

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08887
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Mu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22272
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Mu02
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22272
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22273
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.1kDa
  • Isoelectric Point: 9.3
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Ra02
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22273
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.0kDa
  • Isoelectric Point: 6.1
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Ra03
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22273
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.0kDa
  • Isoelectric Point: 5.7
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

Recombinant Interleukin 6 Receptor (IL6R)

4-RPB815Ra04
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22273
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Interleukin 6 Receptor expressed in: E.coli

IL6R ELISA Kit (Human) (OKAN04562)

OKAN04562 96 Wells
EUR 792
Description: Description of target: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

IL6R ELISA Kit (Rat) (OKAN06520)

OKAN06520 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

IL6R ELISA Kit (Human) (OKBB00811)

OKBB00811 96 Wells
EUR 505
Description: Description of target: IL6R alpha(IL6RA) also known as CD126 or IL6R, is a type I cytokine receptor. The IL6 receptor is a protein complex consisting of a IL-6 receptor subunit(IL6R) and interleukin 6 signal transducer Glycoprotein 130. IL6R also denotes the human gene encoding this subunit. Alternatively spliced transcript variants encoding distinct isoforms have been reported. IL6R subunit is also shared by many other cytokines. Interleukin-6 receptor has been shown to interact with Interleukin 6 and Ciliary neurotrophic factor. Ligand binding did not appear to affect IL6R dimerization status. IL6R dimerization occurs both on the cell surface and in solution.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

IL6R ELISA Kit (Human) (OKCD07685)

OKCD07685 96 Wells
EUR 936
Description: Description of target: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.67ng/mL

IL6R ELISA Kit (Rat) (OKCD07687)

OKCD07687 96 Wells
EUR 1001
Description: Description of target: alpha subunit of the interleukin 6 receptor complex.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

IL6R ELISA Kit (Rat) (OKEH04094)

OKEH04094 96 Wells
EUR 596
Description: Description of target: alpha subunit of the interleukin 6 receptor complex [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.32 pg/mL

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC

4-PAB815Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Biotinylated

4-PAB815Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Cy3

4-PAB815Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), FITC

4-PAB815Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), HRP

4-PAB815Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), PE

4-PAB815Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC

4-PAB815Mu02-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Biotinylated

4-PAB815Mu02-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), Cy3

4-PAB815Mu02-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), FITC

4-PAB815Mu02-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), HRP

4-PAB815Mu02-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), PE

4-PAB815Mu02-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC

4-PAB815Ra01-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated

4-PAB815Ra01-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3

4-PAB815Ra01-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC

4-PAB815Ra01-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP

4-PAB815Ra01-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE

4-PAB815Ra01-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC

4-PAB815Ra02-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated

4-PAB815Ra02-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3

4-PAB815Ra02-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC

4-PAB815Ra02-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP

4-PAB815Ra02-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE

4-PAB815Ra02-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC

4-PAB815Ra03-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated

4-PAB815Ra03-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3

4-PAB815Ra03-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC

4-PAB815Ra03-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP

4-PAB815Ra03-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE

4-PAB815Ra03-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC

4-PAB815Ra04-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated

4-PAB815Ra04-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3

4-PAB815Ra04-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC

4-PAB815Ra04-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP

4-PAB815Ra04-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE

4-PAB815Ra04-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC

4-PAB815Ra05-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Biotinylated

4-PAB815Ra05-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Biotin.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), Cy3

4-PAB815Ra05-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with Cy3.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), FITC

4-PAB815Ra05-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with FITC.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), HRP

4-PAB815Ra05-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with HRP.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), PE

4-PAB815Ra05-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with PE.

Rat Interleukin 6 Receptor (IL6R) Protein

20-abx167762
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) Protein

20-abx167763
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Interleukin 6 Receptor (IL6R) Protein

20-abx067543
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein

20-abx067544
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein

20-abx067545
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Interleukin 6 Receptor (IL6R) Protein

20-abx067546
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) Protein

20-abx067548
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Anti-IL6R (Tocilizumab)-SMCC-DM1 ADC

ADC-W-1442 1mg Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a SMCC linker to DM1

Anti-IL6R (Tocilizumab)-SPDB-DM4 ADC

ADC-W-1443 1mg Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a SPDB linker to DM4

Anti-IL6R (Tocilizumab)-MC-MMAF ADC

ADC-W-1444 1mg Ask for price
Description: This ADC product is comprised of an anti-IL6R monoclonal antibody conjugated via a MC linker to MMAF

Il6r sgRNA CRISPR Lentivector set (Rat)

K6857401 3 x 1.0 ug
EUR 339

IL6R sgRNA CRISPR Lentivector set (Human)

K1076501 3 x 1.0 ug
EUR 339

Recombinant IL6R Protein (Met1-Pro365) [His]

VAng-Cr3770-100g 100 µg
EUR 1388
Description: Recombinant IL6R Protein (Met1-Pro365) fused with a His tag at C-terminus was expressed in Mammalian cells, with a molecular weight of 65 kDa. (Uniprot ID: P08887)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Human, Mouse, Rat)

4-PAB815Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Pro216~Val356)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Interleukin 6 Receptor (IL6R)

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB815Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Phe205~Glu347)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB815Mu02-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala52~Ala204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7

4-PAB815Ra01-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Leu385~Arg462)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7

4-PAB815Ra02-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7

4-PAB815Ra03-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Asp214~Ala348)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7

4-PAB815Ra04-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6R (Ala19~Val108)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Interleukin 6 Receptor (IL6R) Polyclonal Antibody (Rat), APC-Cy7

4-PAB815Ra05-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala19~Val10
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 6 Receptor (IL6R). This antibody is labeled with APC-Cy7.

Human Interleukin-6 receptor subunit alpha (IL6R)

1-CSB-YP011665HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-6 receptor subunit alpha(IL6R),partial expressed in Yeast

Human Interleukin 6 Receptor, IL6R ELISA Kit

DEIA262 5 plates
EUR 1361
Description: The Human IL6R ELISA kit is for the quantitative determination of Human IL6R.;This ELISA kit contains the basic components required for the development of sandwich ELISAs. Each kit contains sufficient materials to run ELISAs on five 96-well plates.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

20-abx155686
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit

20-abx154201
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit

20-abx151950
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

abx255770-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Interleukin 6 Receptor (IL6R) ELISA Kit

abx257871-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit

abx253572-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rabbit Interleukin 6 Receptor (IL6R) ELISA Kit

abx362587-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Interleukin 6 Receptor (IL6R) ELISA Kit

abx357164-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Interleukin 6 Receptor (IL6R) ELISA Kit

abx573463-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) ELISA Kit

abx574107-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) Protein (Active)

20-abx651400
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit

abx575657-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Interleukin 6 Receptor (IL6R) ELISA Kit

abx518524-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Interleukin 6 Receptor (IL6R) CLIA Kit

20-abx493109
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Interleukin 6 Receptor (IL6R) CLIA Kit

20-abx493110
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Interleukin 6 Receptor (IL6R) CLIA Kit

20-abx493111
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Il6r sgRNA CRISPR Lentivector (Rat) (Target 1)

K6857402 1.0 ug DNA
EUR 154

Il6r sgRNA CRISPR Lentivector (Rat) (Target 2)

K6857403 1.0 ug DNA
EUR 154

Il6r sgRNA CRISPR Lentivector (Rat) (Target 3)

K6857404 1.0 ug DNA
EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 1)

K1076502 1.0 ug DNA
EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 2)

K1076503 1.0 ug DNA
EUR 154

IL6R sgRNA CRISPR Lentivector (Human) (Target 3)

K1076504 1.0 ug DNA
EUR 154

IL6R Protein Vector (Rat) (pPB-C-His)

PV274586 500 ng
EUR 603

IL6R Protein Vector (Rat) (pPB-N-His)

PV274587 500 ng
EUR 603

IL6R Protein Vector (Rat) (pPM-C-HA)

PV274588 500 ng
EUR 603

IL6R Protein Vector (Rat) (pPM-C-His)

PV274589 500 ng
EUR 603

IL6R Protein Vector (Human) (pPB-C-His)

PV053433 500 ng
EUR 481

IL6R Protein Vector (Human) (pPB-N-His)

PV053434 500 ng
EUR 481

IL6R Protein Vector (Human) (pPM-C-HA)

PV053435 500 ng
EUR 481

IL6R Protein Vector (Human) (pPM-C-His)

PV053436 500 ng
EUR 481

IL6R Protein Vector (Human) (pPB-C-His)

PV053437 500 ng
EUR 481

IL6R Protein Vector (Human) (pPB-N-His)

PV053438 500 ng
EUR 481

IL6R Protein Vector (Human) (pPM-C-HA)

PV053439 500 ng
EUR 481

IL6R Protein Vector (Human) (pPM-C-His)

PV053440 500 ng
EUR 481

Human Interleukin 6 Receptor(IL6R)ELISA Kit

QY-E04261 96T
EUR 374

Rat Interleukin 6 Receptor(IL6R)ELISA Kit

QY-E10061 96T
EUR 361

Human Interleukin 6 Receptor (IL6R) ELISA Kit

SEB815Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.

Human Interleukin 6 Receptor (IL6R) ELISA Kit

SEB815Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.

Human Interleukin 6 Receptor (IL6R) ELISA Kit

SEB815Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 6 Receptor (IL6R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 6 Receptor (IL6R) in serum, plasma, urine, tissue homogenates and other biological fluids.
October 2021
M T W T F S S
 123
45678910
11121314151617
18192021222324
25262728293031

Recent Posts

Categories

Tags